../../tmp/servers/virsirnadb/236746484
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi10091actccaccatagatcactcc20
X61596.1 Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene7....................26100
D13558.1HPCJ483 Hepatitis C virus genome, complete sequence 24....................43100
D10750.1HPCJ491 Hepatitis C virus genome, complete sequence 24....................43100
D90208.1HPCJCG Hepatitis C virus ORF gene, complete cds 12....................31100
D11168.1HPCJTA Hepatitis C virus (HCV) complete genome 24....................43100
D11355.1HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' 24....................43100
M96362.1HPCUNKCDS Hepatitis C virus mRNA, complete cds 25....................44100
L02836.1HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome 13....................32100
M84754.1HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome24....................43100
M58335.1HPCHUMR Hepatitis C virus subtype 1b, complete genome 15....................34100
S62220.1 Hepatitis C virus subtype 1b, complete genome 23....................42100
U01214.1HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome 25....................44100
D10934.1HPCRNA Hepatitis C virus RNA, complete genome sequence 24....................43100
D30613.1HPCPP Hepatitis C virus complete genome sequence 24....................43100
U16362.1HCU16362 Hepatitis C virus subtype 1b, complete genome 25....................44100
D50482.1HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g12....................31100
D50483.1HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g12....................31100
D50484.1HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g12....................31100
D50485.1HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g12....................31100
D50481.1HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g12....................31100
D50480.1HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g12....................31100
D14484.1HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome 24....................43100
U45476.1HCU45476 Hepatitis C virus isolate HD-1, complete genome 24....................43100
D45172.1HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd24....................43100
D85516.1 Hepatitis C virus genomic RNA, complete cds 24....................43100
U89019.1HCU89019 Hepatitis C virus subtype 1b, complete genome 24....................43100
AJ000009.1 Hepatitis C virus complete genome sequence 7....................26100
AF054250.1 Hepatitis C virus subtype 1b strain HC-J4, complete genome 14....................33100
AJ132996.1 Hepatitis C virus, complete genome, isolate HCV-AD78 23....................42100
AJ132997.1 Hepatitis C virus, complete genome, isolate HCV-AD78P1 23....................42100
AJ238799.1 Hepatitis C virus type 1b complete genome, isolate Con1 24....................43100
AF176573.1 Hepatitis C virus subtype 1b strain 274933RU, complete genome 24....................43100
AB016785.1 Hepatitis C virus genomic RNA, complete sequence 24....................43100
AF165045.1 Hepatitis C virus subtype 1b strain MD1-1, complete genome 12....................31100
AF165046.1 Hepatitis C virus subtype 1b strain MD1-2, complete genome 12....................31100
AF165047.1 Hepatitis C virus subtype 1b strain MD2-1, complete genome 12....................31100
AF165048.1 Hepatitis C virus subtype 1b strain MD2-2, complete genome 12....................31100
AF165049.1 Hepatitis C virus subtype 1b strain MD3-1, complete genome 12....................31100
AF165051.1 Hepatitis C virus subtype 1b strain MD4-1, complete genome 12....................31100
AF165052.1 Hepatitis C virus subtype 1b strain MD4-2, complete genome 12....................31100
AF165053.1 Hepatitis C virus subtype 1b strain MD5-1, complete genome 12....................31100
AF165054.1 Hepatitis C virus subtype 1b strain MD5-2, complete genome 12....................31100
AF165055.1 Hepatitis C virus subtype 1b strain MD6-1, complete genome 12....................31100
AF165056.1 Hepatitis C virus subtype 1b strain MD6-2, complete genome 12....................31100
AF165057.1 Hepatitis C virus subtype 1b strain MD7-1, complete genome 12....................31100
AF165058.1 Hepatitis C virus subtype 1b strain MD7-2, complete genome 12....................31100
AF165059.1 Hepatitis C virus subtype 1b strain MD8-1, complete genome 12....................31100
AF165060.1 Hepatitis C virus subtype 1b strain MD8-2, complete genome 12....................31100
AF165061.1 Hepatitis C virus subtype 1b strain MD9-1, complete genome 12....................31100
AF165062.1 Hepatitis C virus subtype 1b strain MD9-2, complete genome 12....................31100
AF165063.1 Hepatitis C virus subtype 1b strain MD10-1, complete genome 12....................31100
AF165064.1 Hepatitis C virus subtype 1b strain MD10-2, complete genome 12....................31100
AF207752.1 Hepatitis C virus subtype 1b strain MD11, complete genome 12....................31100
AF207754.1 Hepatitis C virus subtype 1b strain MD13, complete genome 12....................31100
AF207755.1 Hepatitis C virus subtype 1b strain MD14, complete genome 12....................31100
AF207756.1 Hepatitis C virus subtype 1b strain MD15, complete genome 12....................31100
AF207757.1 Hepatitis C virus subtype 1b strain MD16, complete genome 12....................31100
AF207758.1 Hepatitis C virus subtype 1b strain MD17, complete genome 12....................31100
AF207760.1 Hepatitis C virus subtype 1b strain MD19, complete genome 12....................31100
AF207761.1 Hepatitis C virus subtype 1b strain MD20, complete genome 12....................31100
AF207762.1 Hepatitis C virus subtype 1b strain MD21, complete genome 12....................31100
AF207763.1 Hepatitis C virus subtype 1b strain MD22, complete genome 12....................31100
AF207764.1 Hepatitis C virus subtype 1b strain MD23, complete genome 12....................31100
AF207765.1 Hepatitis C virus subtype 1b strain MD24, complete genome 12....................31100
AF207766.1 Hepatitis C virus subtype 1b strain MD25, complete genome 12....................31100
AF207767.1 Hepatitis C virus subtype 1b strain MD26, complete genome 12....................31100
AF207768.1 Hepatitis C virus subtype 1b strain MD27, complete genome 12....................31100
AF207769.1 Hepatitis C virus subtype 1b strain MD28, complete genome 12....................31100
AF207770.1 Hepatitis C virus subtype 1b strain MD29, complete genome 12....................31100
AF207771.1 Hepatitis C virus subtype 1b strain MD30, complete genome 12....................31100
AF207772.1 Hepatitis C virus subtype 1b strain MD31, complete genome 12....................31100
AF207773.1 Hepatitis C virus subtype 1b strain MD32, complete genome 12....................31100
AF207774.1 Hepatitis C virus subtype 1b strain MD33, complete genome 12....................31100
AB049088.1 Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 24....................43100
AB049094.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT1625....................44100
AB049099.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT2124....................43100
AF333324.1 Hepatitis C virus type 1b polyprotein mRNA, complete cds 24....................43100
AY051292.1 Hepatitis C virus (isolate India) polyprotein mRNA, complete cds 24....................43100
AF356827.1 Hepatitis C virus subtype 1b isolate HCV-S1, complete genome 24....................43100
AY045702.1 Hepatitis C virus isolate HCR6, complete genome 26....................45100
AF139594.2 Hepatitis C virus subtype 1b strain HCV-N, complete genome 24....................43100
AB080299.1 Hepatitis C virus genomic RNA, complete genome, isolate:M1LE 24....................43100
AB154177.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154178.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154179.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154180.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154181.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154182.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154183.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154185.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154186.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154187.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154189.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154190.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154191.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154192.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154194.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154198.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154199.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154200.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154201.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154202.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154203.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154204.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154205.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB154206.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola12....................31100
AB191333.1 Hepatitis C virus genomic RNA, complete genome, strain:0 24....................43100
DQ071885.1 Hepatitis C virus subtype 1b polyprotein mRNA, complete cds 24....................43100
EF026073.1 Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds 1....................20100
AB249644.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 24....................43100
AM408911.1 Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno1....................20100
AB426117.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 24....................43100
AB435162.2 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 24....................43100
AB429050.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 24....................43100
EU857431.1 Hepatitis C virus subtype 1b isolate Whu, complete genome 24....................43100
AB442219.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B-24....................43100
AB442220.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH24....................43100
AB442221.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH24....................43100
AB442222.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B-24....................43100
FN435993.1 Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN24....................43100
GU133617.1 Hepatitis C virus subtype 1b, complete genome 24....................43100
D28917.1HPCK3A Hepatitis C virus (isolate HCV-K3a/650) genomic RNA, complete g22..........g.........4195
D28917.1HPCK3A Hepatitis C virus (isolate HCV-K3a/650) genomic RNA, complete g440.....ca.............42190
AF046866.1 Hepatitis C virus subtype 3a strain CB polyprotein gene, complete cds22..........g.........4195
AF046866.1 Hepatitis C virus subtype 3a strain CB polyprotein gene, complete cds440.........ac....tg...42180
D89815.1 Hepatitis C virus genomic RNA, complete sequence 24.................c..4395
AF207753.1 Hepatitis C virus subtype 1b strain MD12, complete genome 12.t..................3195
AF207759.1 Hepatitis C virus subtype 1b strain MD18, complete genome 12................t...3195
EF407461.1 Hepatitis C virus isolate 5004 polyprotein gene, complete cds 4..............t.....2395
EF407502.1 Hepatitis C virus isolate 2038 polyprotein gene, complete cds 53..............t.....7295
FJ407092.1 Hepatitis C virus isolate IND-HCV-3i, complete genome 22..........g.........4195
GQ275355.1 Hepatitis C virus subtype 3a, complete genome 22..........g.........4195
GQ275355.1 Hepatitis C virus subtype 3a, complete genome 440.........ac....tg...42180
D17763.1HPCEGS Hepatitis C virus (isolate NZL1) genomic RNA, complete genome 22..........g.........4195
D17763.1HPCEGS Hepatitis C virus (isolate NZL1) genomic RNA, complete genome 440.........ac....tg...42180
EF032892.1 Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge2__..................1990
D10749.1HPCHCJ1 Hepatitis C virus genomic RNA, complete genome, isolate: HC-J124..........ga........4390
M67463.1HPCCGAA Hepatitis C virus subtype 1a, complete genome 24..........ga........4390
M62321.1HPCPLYPRE Hepatitis C virus subtype 1a, complete genome 24..........ga........4390
D49374.1HPCFG Hepatitis C virus (isolate Tr Kj) genomic RNA, complete genome 22..........ga........4190
D63821.1HPCJK049E1 Hepatitis C virus (isolate JK049) genomic RNA, complete gen22..........ga........4190
AF011751.1 Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds 24..........ga........4390
AF011752.1 Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds 24..........ga........4390
AF011753.1 Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds 24..........ga........4390
AF054247.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete24..........ga........4390
AF054248.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete24..........ga........4390
AF054249.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete24..........ga........4390
AF208024.1 Hepatitis C virus subtype 1b strain MD34, complete genome 12.t..............t...3190
AF271632.1 Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome 24..........ga........4390
AJ278830.1 Hepatitis C virus genomic RNA for polyprotein gene 24..........ga........4390
AF290978.1 Hepatitis C virus subtype 1a isolate colonel, complete genome 12..........ga........3190
AF511949.1 Hepatitis C virus isolate XF223 polyprotein-like gene, complete seque24..........ga........4390
AY878650.1 Hepatitis C virus subtype 6k isolate KM45, complete genome 7..........ga........2690
EF621489.1 Hepatitis C virus subtype 1a strain HC-TN, complete genome 24..........ga........4390
EF632071.1 Hepatitis C virus isolate VT21, complete genome 7..........ga........2690
AB520610.1 Hepatitis C virus subtype 1a genomic RNA, complete genome, strain: HC24..........ga........4390
AF009606.1 Hepatitis C virus subtype 1a polyprotein gene, complete cds 24..........ga........4390
EF407483.1 Hepatitis C virus isolate 4043 polyprotein gene, complete cds 1__............t.....1885
DQ155561.1 Hepatitis C virus (isolate D54) polyprotein gene, partial cds 1_____...............1575
EU246930.1 Hepatitis C virus strain D9 polyprotein gene, complete cds 1_____...............1575
EU246933.1 Hepatitis C virus strain D33 polyprotein gene, complete cds 1_____...............1575
EU246939.1 Hepatitis C virus strain D49 polyprotein gene, complete cds 1_____...............1575
FJ821465.1 Hepatitis C virus strain M21-2k/1b, complete genome 2_____...............1675
AF165050.1 Hepatitis C virus subtype 1b strain MD3-2, complete genome 12.t............a.t...3185
AF511948.1 Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque24..........ga..t.....4385
AY460204.1 Hepatitis C virus from Shanghai, complete genome 24..........ga.c......4385
EF407501.1 Hepatitis C virus isolate 7055 polyprotein gene, complete cds 1____..........t.....1675
AM910652.2 Hepatitis C virus subtype 1g complete genome 1_____.....g.........1570
X76918.1 Hepatitis C virus genes for core, envelope and NS1 proteins 399.........ac....tg...38080
AY651061.1 Hepatitis C virus isolate Khaja1, complete genome 442.........ac....tg...42380
DQ437509.2 Hepatitis C virus isolate 452 polyprotein gene, partial cds 101.........ac....tg...8280
EF407442.1 Hepatitis C virus isolate 8012 polyprotein gene, complete cds 356.........ac....tg...33780
EU362898.1 Hepatitis C virus isolate 8012_FU24 polyprotein (pol) gene, complete 346.........ac....tg...32780
EU482833.1 Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet390.........ac....tg...37180
EU155314.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V414/2004, complet316.........ac....tg...29780
EU529676.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V39/2004, complete374.........ac....tg...35580
EU687195.1 Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V1564/2007, comple376.........ac....tg...35780
EU255958.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V265/2005, complet368.........ac....tg...34980
FJ462431.1 Hepatitis C virus isolate QC139, complete genome 23..........ga.c.g....4280
FJ462432.1 Hepatitis C virus isolate QC193, complete genome 23..........ga.c.g....4280
FJ462433.1 Hepatitis C virus isolate QC249, complete genome 23..........ga.c.g....4280
FJ462434.1 Hepatitis C virus isolate QC262, complete genome 23..........ga.c.g....4280
FJ462435.1 Hepatitis C virus isolate QC264, complete genome 23..........ga.c.g....4280
FJ462436.1 Hepatitis C virus isolate QC381, complete genome 23..........ga.c.g....4280
FJ462437.1 Hepatitis C virus isolate QC382, complete genome 23..........ga.c.g....4280
FJ462438.1 Hepatitis C virus isolate QC383, complete genome 23..........ga.c.g....4280
FJ462439.1 Hepatitis C virus isolate QC384, complete genome 23..........ga.c.g....4280
FJ462440.1 Hepatitis C virus isolate QC93, complete genome 23..........ga.c.g....4280
FJ462441.1 Hepatitis C virus isolate QC97, complete genome 23..........ga.c.g....4280
FJ839869.1 Hepatitis C virus isolate QC155, complete genome 23..........ga.c.g....4280
FJ839870.1 Hepatitis C virus isolate QC274, complete genome 23..........ga.c.g....4280
AB049087.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT051________............1260
AB049089.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT101________............1260
AB049090.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT141________............1260
AB049092.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT141________............1260
AB049093.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT151________............1260
AB049095.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT161________............1260
AB049096.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT191________............1260
AB049097.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT191________............1260
AB049098.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT201________............1260
AB049100.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT211________............1260
AB049101.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT221________............1260
EF407487.1 Hepatitis C virus isolate 6057 polyprotein gene, complete cds 5542............________553160